Transcription
Study Questions
1. The antibiotic "Cordycepin" is shown below. Of what nucleoside is it an analog? Why does it inhibit bacterial RNA synthesis?

2. For the E. coliTyr Promoter:
5’ CAACGTAACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATA 3’
3’ GTTGCATTGTGAAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAGGGCTAT 5’
Indicate the -10 region, the -35 region, and the initiating nucleotide on the sense strand.
3. Explain the effects of Gyrase mutants and of Topoisomerase I mutants on transcription of plasmids in E. coli.
4. An experiment is done in which a certain RNAPII is incubated with an inhibitor of RNA chain elongation:
3'-deoxy-5'[a-32P] CTP
No 32P was found in the transcribed RNA. What might you conclude from this finding?
5. Draw the structures of the side chains that correspond to the following histone modifications, and explain how each modification might affect replication or transcription:
a) Acetylation of Lys
b) Phosphorylation of Ser
c) Phosphorylation of His
d) Methylation of Lys
e) Methylation of Arg
6. Explain the chemical reactions of the 5'-capping of the emerging mRNA and discuss the reason(s) for this post-transcriptional modification.
7. Discuss the 3'-polyadenylation (post-transcriptional) modification of mRNA. Mention the chemical reactions that occur, the enzyme(s) involved, and the
possible purpose(s) of polyadenylation.
8. If I give you the consensus sequence of eukaryotic mRNA splice sites, explain the mechanism of mRNA splicing. Make sure that you mention the kinds of chemical reactions that occur in this process and be able to show the specific groups involved in the bond-making and bond-breaking process. What can you conclude about the free energy change for the splicing reaction?
9. Differentiated cells are distinctive because of the particular set of activators and repressors that they contain. What controls the production of these proteins?